pUC/M13 Primer, Reverse (17mer), 2 µg, Promega
Supplier: Promega Corporation
Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.
- Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
- Supplied at a concentration of 10microg/ml
The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.
Learn more

About VWR
Avantor is a vertically integrated, global supplier of discovery-to-delivery solutions for...